|
Errata.(Vol. 6, No. 5 and Vol. 7, No. 1)(Correction Notice)
Emerging Infectious Diseases
|
May 1, 2001
|
COPYRIGHT 2001 U.S. National Center for Infectious Diseases. This material is published under license from the publisher through the Gale Group, Farmington Hills, Michigan. All inquiries regarding rights should be directed to the Gale Group.
(Hide copyright information)
Copyright
|
Vol. 6, No. 5
In the article, "Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska," by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene. The first complete sentence at the top of column 1, page 531, should read, "The following set of primers, which detects both [stx.sub.1] and [stx.sub.2], was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'." We regret any confusion this error may have caused.
Vol. 7, No. 1
In the ...
|
Hydrographic and current measurements in the area of the Angola-Benguela front
Magazine article from: Journal of Physical Oceanography
; ...structure and flow in the area of the Angola-Benguela front was studied under the auspices of BENEFIT (Benguela Environment-Fisheries Interaction and...350S and 10'W, 20'E. The Angola-Benguela Front was observed at 16'30'S separating...
|
|
SA, Angola and namibia set up benguela current commission.(News)
Newspaper article from: Cape Times (South Africa)
; ...their support for the establishment of a Benguela Current Commission - a formal institutional...conservation and sustainable use of the Benguela Current Large Marine Ecosystem (BCLME...international shipping. The planned Benguela Current Commission will implement an...
|
|
Chevron Receives Offshore Energy Achievement Award for Its Benguela Belize Project in Angola.
PR Newswire
; ...Corporation today announced that its Benguela Belize drilling and production platform...manage large and complex projects." Benguela Belize-Lobito Tomboco (BBLT), one...capacity of 220,000 barrels per day. "Benguela Belize demonstrates how Chevron is achieving...
|
|
benguela current warming up.(News)
Newspaper article from: Cape Times (South Africa)
; ...as possible because big changes in the Benguela ecosystem mean it will become increasing...a workshop on climate change and the Benguela current ecosystem last week. At a briefing...one degree Celsius warming trend of the Benguela over the past 25 years. Other findings...
|
|
Endangered turtles and millions of sharks killed in Benguela butchery.(News)
Newspaper article from: Cape Argus (South Africa)
; ...long-line fishing operations in the Benguela Current ecosystem. About 200 of these...Approach to Long-line Fisheries in the Benguela: An assessment of impacts on seabirds...fleets operating on the high seas in the Benguela region contribute to the demise of about...
|
|
Majestic and still undiscovered; Angola's Benguela has sun, beaches, beauty and wide open arms.(Travel-Books)
Newspaper article from: Albany Times Union (Albany, NY)
; ...and surreal confines of coastal Benguela, Angola's second-largest city...Founded by the Portuguese in 1617, Benguela is a former slave port and the erstwhile...terminus of the cross-continental Benguela Railway. Situated 434 miles south...
|
|
Rehabilitation of Benguela Railway in Angola
Newspaper article from: Xinhua English Newswire
; ...work on Angola's major railway the Benguela line has started. The work will be completed in three years. The 1,340-km Benguela line runs across the central part of...the Democratic Republic of Congo. The Benguela line, which links Tazara via the railway...
|
|
Namibia: Benguela Commission Given Multi-Million Boost.
News Wire article from: TendersInfo
; Byline: Mamta03 The Benguela Current Commission (BCC) on Friday...will strengthen the capacity of the Benguela Current Commission through a training...approach to fisheries management. The Benguela Current Commission was established...
|
|
Namibia: Benguela project gets funding boost.
News Wire article from: TendersInfo
; ...administering the marine resources of the Benguela current. UNDP Resident Representative...used to strengthen the capacity of the Benguela Current Commission (BCC) through a...served as a viable entity in managing the Benguela Current Large Marine Ecosystem (BCLME...
|
|
Chevron Announces First Oil Production From Benguela-Belize Development, Deepwater Block 14, Offshore Angola.
PR Newswire
; ...deepwater Block 14 offshore Angola. The Benguela, Belize, Lobito and Tomboco fields...production milestone. In December 2005, the Benguela Belize drilling and production platform...most important, in a safe manner. Benguela Belize clearly demonstrates the company...
|
Find more facts and information related to the
article "Errata.(Vol. 6, No. 5 and Vol. 7, No. ..."