DNA
From: The Columbia Encyclopedia, Sixth Edition
|
Date: 2008
DNA see nucleic acid .
Author not available, DNA.,
The Columbia Encyclopedia, Sixth Edition 2008
The Columbia Encyclopedia, Sixth Edition. Copyright 2008 Columbia University Press
For permission to reuse this article, contact Copyright Clearance Center.
Related articles from HighBeam Research:
|
Temperature Dependence and Thermodynamics of Klenow Polymerase Binding to Primed-Template DNA
Biophysical Journal; 3/1/2006; Datta, Kausiki; Wowor, Andy J; Richard, Allison J; LiCata, Vince J; 9676 words;
ABSTRACT DNA binding of Klenow polymerase has been characterized ... interaction of this polymerase with primed-template DNA. The temperature dependence of the binding ... proposed to be a 'signature' of site-specific DNA binding, but type I DNA polymerases do not ...
|
|
|
The B- to A-DNA Transition and the Reorganization of Solvent at the DNA Surface
Biophysical Journal; 5/1/2005; Pastor, Nina; 9880 words;
... 1995) potential to convert DNA oligomers into an A-DNA conformation (Feig and Pettitt, 1997, 1998; Yang and ... possible basepair steps was chosen for the double-stranded DNA 24-mer subject of this study: d(CTGTATCTATATAAAACGGGCTGG ... previous studies of the hydration of dinucleotide-repeating DNA ...
|
|
DNA Polymerases that Propagate the Eukaryotic DNA Replication Fork
Critical Reviews in Biochemistry and Molecular Biology; 3/1/2005; Garg, Parie; Burgers, Peter M J; 10634 words;
ABSTRACT Three DNA polymerases are thought to function at the eukaryotic DNA replication fork. Currently, a coherent model has been ... composition and activities of the lagging strand machinery. RNA-DNA primers are initiated by DNA polymerase α-primase ...
|
|
Multiple Functions of DNA Polymerases
Critical Reviews in Plant Sciences; 1/1/2007; Garcia-Diaz, Miguel; Bebenek, Katarzyna; 15102 words;
The primary role of DNA polymerases is to accurately and efficiently replicate the ... and its constant exposure to endogenous and environmental DNA damaging agents. Thus, a number of DNA repair pathways operate in cells to protect the integrity ...
|
|
The constitutionality of DNA sampling on arrest.
Cornell Journal of Law and Public Policy; 6/22/2001; Kaye, D.H.; 28103 words;
... was analyzed using DNA technology. When the resulting DNA profile was searched against Minnesota's database, a ... the police had given up on. See, e.g., C.J. Chivers, DNA Match Implicates Inmate in '79 Murder, Officials Say ... Jayson Blair, N.Y. State to Develop Database on Felons' DNA as ...
|
|
DNA database searches and the legal consumption of scientific evidence.
Michigan Law Review; 2/1/1999; Donnelly, Peter Friedman, Richard D.; 23974 words;
DNA evidence has transformed the proof of identity in criminal ... process. In this Article, we analyze a problem related to DNA evidence that is likely to be of great and increasing significance ... present evidence that the suspect has been identified through a DNA database search. In our view, the two ...
|
|
Approaches to Enhance the Efficacy of DNA Vaccines
Critical Reviews in Clinical Laboratory Sciences; 1/1/2004; Manoj, Sharmila; Babiuk, Lorne A; Littel-van den Hurk, Sylvia van Drunen; 18660 words;
ABSTRACT: DNA vaccines consist of antigen-encoding bacterial ... vaccine production. However, the entry of DNA vaccines and expression of antigen are subjected ... host-imposed impediments have not prevented DNA vaccines from inducing long-lasting, protective ...
|
|
|
On the competition between water, sodium ions, and spermine in binding to DNA: A molecular dynamics computer simulation study
Biophysical Journal; 6/1/2002; Korolev, Nikolay; Lyubartsev, Alexander P; Laaksonen, Aatto; Nordenskiold, Lars; 10590 words;
... crystallography and MD simulation methods in describing DNA hydration and ligand interactions. The figure compares ... represent only a fraction of all species present in the DNA crystal and cannot be quantitatively compared with the ... solvent molecules and other substances, absorbed in the DNA crystal ...
|
|
|
T-DNA tagging in a genomics era
Critical Reviews in Plant Sciences; 1/1/2002; Walden, Richard; 15316 words;
ABSTRACT: From a relatively simple start, T-DNA tagging has emerged to become an important ... primarily used as a means of gene isolation. A T-DNA insertion might result in an obvious, changed ... transgenic plant populations where collectively T-DNA insertions may saturate the genome, T-DNA ...
|
|
|
Plant DNA Topoisomerases: Structure, Function, and Cellular Roles in Plant Development
Critical Reviews in Plant Sciences; 1/1/2004; Singh, B N; Sopory, S K; Reddy, M K; 14197 words;
Regulation of the topological state of DNA is critical for cellular viability. DNA topoisomerases alter DNA topology and participate in nearly all events related to DNA metabolism such as replication, transcription, recombination, and chromosome segregation ...
|
|
T-DNA Integration in Arabidopsis Chromosomes. Presence and Origin of Filler DNA Sequences1[w]
Plant Physiology; 12/1/2003; Windels, Pieter; De Buck, Sylvie; Van Bockstaele, Erik; De Loose, Marc; Depicker, Ann; 6338 words;
To investigate the relationship between T-DNA integration and double-stranded break (DSB) repair in Arabidopsis, we studied 67 T-DNA/plant DNA junctions and 13 T-DNA/T-DNA junctions derived from transgenic ...
|
|
|
Ligand-Induced DNA Condensation: Choosing the Model
Biophysical Journal; 10/1/2005; Teif, Vladimir B; 9564 words;
... compare different models for ligand-induced DNA condensation. Using ^sup 14^C-labeled spermidine^sup 3+^, we measure the binding to condensed DNA at micromolar to molar polyamine concentrations. DNA aggregates at a critical polyamine concentration ...
|
|
|
Transcription of Giant DNA Complexed with Cationic Nanoparticles as a Simple Model of Chromatin
Biophysical Journal; 2/15/2007; Zinchenko, Anatoly A; Luckel, François; Yoshikawa, Kenichi; 6220 words;
... prepared complexes of giant double-stranded DNA with cationic nanoparticles of 10-40 nm ... transcriptional activity that accompanied the DNA conformational transitions. Complete inhibition ... In contrast, at intermediate stages of DNA binding with nanoparticles, the transcription ...
|
|
|
Dynamics of Loading the Escherichia coli DNA Polymerase Processivity Clamp
Critical Reviews in Biochemistry and Molecular Biology; 5/1/2006; Bloom, Linda B; 17132 words;
... Sliding clamps and clamp loaders are processivity factors required for efficient DNA replication. Sliding clamps are ring-shaped complexes that tether DNA polymerases to DNA to increase the processivity of synthesis. Clamp loaders assemble these ring ...
|
|
|
Interhelical Spacing in Liquid Crystalline Spermine and Spermidine-DNA Precipitates
Biophysical Journal; 1/1/2005; Raspaud, E; Durand, D; Livolant, F; 7713 words;
ABSTRACT The structure of polyamines-DNA precipitates was studied by x-ray diffraction ... obtained at different NaCl, polyamine, and DNA concentrations. Most of the results were ... regulate the value of the cohesive energy of DNA. These results are discussed in relation ...
|
See all results from premium newspaper and magazine articles, images, maps and more at HighBeam Research.
Related articles from newspapers, magazines and other sources:
An army of suspects: the history and constitutionality of the U.S. military's DNA repository and its access for law enforcement purposes.
Army Lawyer; 7/1/2003; Ham, Patricia A.; 12903 words;
|
Ozonation of DNA forms adducts: a 32P-DNA labeling and thin-layer chromatography technique to measure DNA environmental biomarkers.
Archives of Environmental Health; 1/1/1994; Cajigas, Antonio Gayer, Mitchell Beam, Carl Steinberg, J.J.; 8320 words;
|
Unlocking the Cells.(postconviction DNA testing of prisoners)
Reason; 1/1/2000; Bailey, Ronald; 1528 words;
|
DNA fingerprinting of Mycobacterium tuberculosis: lessons learned and implications for the future. (Tuberculosis Genotyping Network).
Emerging Infectious Diseases; 11/1/2002; McNabb, Scott J.N. Braden, Christopher R. Navin, Thomas R.; 6045 words;
|
The Microscopic Slide.(DNA in criminal investigations)
The FBI Law Enforcement Bulletin; 11/1/2000; SMIALEK, JOHN E. WORD, CHARLOTTE WESTVEER, ARTHUR E.; 1927 words;
|
Microdose DNA (Mucolyxir) for alleviating symptoms of acute and chronic respiratory diseases and otitis media.
Townsend Letter for Doctors and Patients; 11/1/2005; Mamber, Stephen W. McMichael, John; 3761 words;
|
Phylogeographic analysis of mitochondrial DNA variation in Alaskan coho salmon, Oncorhynchus kisutch.(Statistical Data Included)
Fishery Bulletin; 10/1/2001; Gharrett, Anthony J. Gray, Andrew K. Brykov, Vladimir; 10813 words;
|
Structural changes in gill DNA reveal the effects of contaminants on Puget Sound fish.
Environmental Health Perspectives; 4/1/2004; Malins, Donald C. Stegeman, John J. Anderson, Jack W. Johnson, Paul M. Gold, Jordan Anderson, Katie M.; 5234 words;
|
DNA and family puzzles.(Feature on Wills and Estates)
LawNow; 2/1/2004; Clay, Jennifer; 1240 words;
|
Web Studio Stays Strong in Lean Times.(DNA Studio partners with Michael Davies)(Brief Article)
Los Angeles Business Journal; 4/16/2001; IBOLD, HANS; 727 words;
|
|
|